Search academic texts

Information × Registration Number 0221U102301, 0116U000724 , R & D reports Title Experimental study of biotechnology constructing of specific prevention and diagnosis of porcine circovirus popup.stage_title Head Sytiuk Mykola P., Доктор ветеринарних наук Registration Date 30-01-2021 Organization THE INSTITUTE OF VETERINARI MEDICINE OF THE NATIONAL ACADEMY OF AGRARIAN SCIENCES OF UKRAINE popup.description2  According to the results of three-years serological monitoring of domestic pigs for circovirus infection in pig farms of Ukraine, which were not vaccinated against this disease, the overall seroprevalence rate was 67.6%, and in terms of years the percentage of positive samples from the number of subjects was 62.4% in 2013 year, 67.0% and 83.29% in 2014 and 2015, respectively. The processed data of serological researches allow to state that the causative agent of a circovirus infection circulates in herds of domestic pigs in the territory of Ukraine. Primers PCV-2-F GCCACAGCCCTAACCTATGA PCV-2-R TCAGCCAAAGCTGATTCCTT FAM-CTACTCCTCCCGCCATACAA-BHQ1 on the gene encoding the capsid protein of circovirus type II were designed. By full-genome sequencing and analysis, it was found that the isolate DP_UKR_2.16-5 belongs to group 1A / 1B, and the isolate DP_UKR_5.16-6 - to group 1C, 99-100% genetically similar to isolates isolated from both European and Asian countries. Validation tests of the ELISA test system established its diagnostic sensitivity - 85.7%, diagnostic specificity - 88.0%, overall efficiency - 86.6%. An experimental sample vaccine"Inactivated emulsified swine against circovirus pigs" has been developed and tested, which is Product Description popup.authors popup.nrat_date 2021-01-29 Close